Skip to main content
Free research Free research Free assay review with research home and workspace preview
Quick search ChEMBL 36
Assay Detail

CHEMBL4428286

Review assay metadata, readout intent, target linkage, and publication context from the same page.

Binding
Inhibition of HIV integrase pre-incubated for 10 mins before addition of oligo-5'-biotin ATGTGGAAAATCTCTAGCA annealed with ACTGCTAGAGATTTTCCACAT 3'-Cy5) substrate
18
Total Activities
18
Compounds Tested
1
Activity Types
0
Assay Parameters

Assay Information

Assay Type Binding
Organism Human immunodeficiency virus
Confidence 8 — Homologous single protein target
Curated By Autocuration

Target

Human immunodeficiency virus type 1 integrase (CHEMBL3471)
Type SINGLE PROTEIN
Organism Human immunodeficiency virus 1

Publication

3-Hydroxypyrimidine-2,4-diones as Selective Active Site Inhibitors of HIV Reverse Transcriptase-Associated RNase H: Design, Synthesis, and Biochemical Evaluations.
Tang J, Liu F, Nagy E, Miller L, Kirby KA, Wilson DJ, Wu B, Sarafianos SG, Parniak MA, Wang Z.
J Med Chem (2016) 59 : 2648 -2659
PubMed 26927866 · DOI

Activity Statistics

Type Count Avg pChEMBL Best pChEMBL
IC50 18 5.18 6.40

Compounds Tested

Compound Name Phase Activities Best pChEMBL
CHEMBL50605 1 6.40
CHEMBL4545702 1 6.00
CHEMBL4475877 1 5.92
CHEMBL4454510 1 5.89
CHEMBL4581611 1 5.66
CHEMBL4586421 1 5.36
CHEMBL4471489 1 5.34
CHEMBL4472002 1 5.15
CHEMBL4473298 1 5.15
CHEMBL4563474 1 4.92
CHEMBL4437185 1 4.60
CHEMBL4440667 1 4.52
CHEMBL4474029 1 4.46
CHEMBL4453169 1 4.36
CHEMBL4549947 1 4.03
CHEMBL4280869 1 -
CHEMBL4451895 1 -
CHEMBL4531566 1 -

Activity Data

Compound Name Type Rel. Value Units pChEMBL
CHEMBL50605 IC50 = 400.0 nM 6.40
CHEMBL4545702 IC50 = 1000.0 nM 6.00
CHEMBL4475877 IC50 = 1200.0 nM 5.92
CHEMBL4454510 IC50 = 1300.0 nM 5.89
CHEMBL4581611 IC50 = 2200.0 nM 5.66
CHEMBL4586421 IC50 = 4400.0 nM 5.36
CHEMBL4471489 IC50 = 4600.0 nM 5.34
CHEMBL4472002 IC50 = 7100.0 nM 5.15
CHEMBL4473298 IC50 = 7100.0 nM 5.15
CHEMBL4563474 IC50 = 12000.0 nM 4.92
CHEMBL4437185 IC50 = 25000.0 nM 4.60
CHEMBL4440667 IC50 = 30000.0 nM 4.52
CHEMBL4474029 IC50 = 35000.0 nM 4.46
CHEMBL4453169 IC50 = 44000.0 nM 4.36
CHEMBL4549947 IC50 = 93000.0 nM 4.03
CHEMBL4280869 IC50 > 100000.0 nM -
CHEMBL4451895 IC50 > 100000.0 nM -
CHEMBL4531566 IC50 > 100000.0 nM -