Assay Detail
Binding
CHEMBL4715261
Review assay metadata, readout intent, target linkage, and publication context from the same page.
Binding affinity to 5'-FAM/3'-DAB-labeled UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA pre-miRNA-21 (unknown origin) assessed as dissociation constant incubated for overnight in presence of Saccharomyces cerevisiae tRNA by fluorescence based assay
9
Total Activities
9
Compounds Tested
1
Activity Types
0
Assay Parameters
Assay Information
| Assay Type | Binding |
| Organism | Not specified |
| Confidence | 3 — Cell-line / Tissue |
| Curated By | Autocuration |
Publication
Design and Implementation of Synthetic RNA Binders for the Inhibition of miR-21 Biogenesis.
Activity Statistics
| Type | Count | Avg pChEMBL | Best pChEMBL |
|---|---|---|---|
| Kd | 9 | 6.68 | 7.30 |
Compounds Tested
| Compound | Name | Phase | Activities | Best pChEMBL |
|---|---|---|---|---|
| CHEMBL4741693 | — | — | 1 | 7.30 |
| CHEMBL4790732 | — | — | 1 | 7.29 |
| CHEMBL4762976 | — | — | 1 | 6.87 |
| CHEMBL4755325 | — | — | 1 | 6.82 |
| CHEMBL4793684 | — | — | 1 | 6.78 |
| CHEMBL4744263 | — | — | 1 | 6.77 |
| CHEMBL4761635 | — | — | 1 | 6.39 |
| CHEMBL4779103 | — | — | 1 | 6.09 |
| CHEMBL184618 | FRAMYCETIN | 3.0 | 1 | 5.85 |
Activity Data
| Compound | Name | Type | Rel. | Value | Units | pChEMBL |
|---|---|---|---|---|---|---|
| CHEMBL4741693 | — | Kd | = | 50.4 | nM | 7.30 |
| CHEMBL4790732 | — | Kd | = | 51.0 | nM | 7.29 |
| CHEMBL4762976 | — | Kd | = | 134.0 | nM | 6.87 |
| CHEMBL4755325 | — | Kd | = | 151.0 | nM | 6.82 |
| CHEMBL4793684 | — | Kd | = | 168.0 | nM | 6.78 |
| CHEMBL4744263 | — | Kd | = | 170.0 | nM | 6.77 |
| CHEMBL4761635 | — | Kd | = | 405.0 | nM | 6.39 |
| CHEMBL4779103 | — | Kd | = | 807.0 | nM | 6.09 |
| CHEMBL184618 | FRAMYCETIN | Kd | = | 1415.0 | nM | 5.85 |