Skip to main content
Free research Free research Free assay review with research home and workspace preview
Quick search ChEMBL 36
Assay Detail

CHEMBL4715263

Review assay metadata, readout intent, target linkage, and publication context from the same page.

Binding
Binding affinity to 5'-FAM/3'-DAB-labeled UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA pre-miRNA-21 (unknown origin) assessed as dissociation constant incubated for overnight in presence of double stranded 15-mer 5'-CGTTTTTATTTTTGC-3' DNA by fluorescence based assay
9
Total Activities
9
Compounds Tested
1
Activity Types
0
Assay Parameters

Assay Information

Assay Type Binding
Organism Not specified
Confidence 3 — Cell-line / Tissue
Curated By Autocuration

Target

microRNA 21 (CHEMBL1615322)
Type NUCLEIC-ACID
Organism Homo sapiens

Publication

Design and Implementation of Synthetic RNA Binders for the Inhibition of miR-21 Biogenesis.
Maucort C,Vo DD,Aouad S,Charrat C,Azoulay S,Di Giorgio A,Duca M
ACS Med Chem Lett (2021) 12 : 899 -906
PubMed 34141067 · DOI

Activity Statistics

Type Count Avg pChEMBL Best pChEMBL
Kd 9 6.48 7.09

Compounds Tested

Compound Name Phase Activities Best pChEMBL
CHEMBL4741693 1 7.09
CHEMBL4790732 1 7.02
CHEMBL4762976 1 6.77
CHEMBL4755325 1 6.73
CHEMBL4744263 1 6.58
CHEMBL4793684 1 6.56
CHEMBL4761635 1 6.06
CHEMBL4779103 1 5.84
CHEMBL184618 FRAMYCETIN 3.0 1 5.71

Activity Data

Compound Name Type Rel. Value Units pChEMBL
CHEMBL4741693 Kd = 80.9 nM 7.09
CHEMBL4790732 Kd = 95.7 nM 7.02
CHEMBL4762976 Kd = 171.0 nM 6.77
CHEMBL4755325 Kd = 187.0 nM 6.73
CHEMBL4744263 Kd = 261.0 nM 6.58
CHEMBL4793684 Kd = 274.0 nM 6.56
CHEMBL4761635 Kd = 877.0 nM 6.06
CHEMBL4779103 Kd = 1459.0 nM 5.84
CHEMBL184618 FRAMYCETIN Kd = 1950.0 nM 5.71