Assay Detail
Binding
CHEMBL4715263
Review assay metadata, readout intent, target linkage, and publication context from the same page.
Binding affinity to 5'-FAM/3'-DAB-labeled UGUCGGGUAGCUUAUCAGACUGAUGUUGACUGUUGAAUCUCAUGGCAACACCAGUCGAUGGGCUGUCUGACA pre-miRNA-21 (unknown origin) assessed as dissociation constant incubated for overnight in presence of double stranded 15-mer 5'-CGTTTTTATTTTTGC-3' DNA by fluorescence based assay
9
Total Activities
9
Compounds Tested
1
Activity Types
0
Assay Parameters
Assay Information
| Assay Type | Binding |
| Organism | Not specified |
| Confidence | 3 — Cell-line / Tissue |
| Curated By | Autocuration |
Publication
Design and Implementation of Synthetic RNA Binders for the Inhibition of miR-21 Biogenesis.
Activity Statistics
| Type | Count | Avg pChEMBL | Best pChEMBL |
|---|---|---|---|
| Kd | 9 | 6.48 | 7.09 |
Compounds Tested
| Compound | Name | Phase | Activities | Best pChEMBL |
|---|---|---|---|---|
| CHEMBL4741693 | — | — | 1 | 7.09 |
| CHEMBL4790732 | — | — | 1 | 7.02 |
| CHEMBL4762976 | — | — | 1 | 6.77 |
| CHEMBL4755325 | — | — | 1 | 6.73 |
| CHEMBL4744263 | — | — | 1 | 6.58 |
| CHEMBL4793684 | — | — | 1 | 6.56 |
| CHEMBL4761635 | — | — | 1 | 6.06 |
| CHEMBL4779103 | — | — | 1 | 5.84 |
| CHEMBL184618 | FRAMYCETIN | 3.0 | 1 | 5.71 |
Activity Data
| Compound | Name | Type | Rel. | Value | Units | pChEMBL |
|---|---|---|---|---|---|---|
| CHEMBL4741693 | — | Kd | = | 80.9 | nM | 7.09 |
| CHEMBL4790732 | — | Kd | = | 95.7 | nM | 7.02 |
| CHEMBL4762976 | — | Kd | = | 171.0 | nM | 6.77 |
| CHEMBL4755325 | — | Kd | = | 187.0 | nM | 6.73 |
| CHEMBL4744263 | — | Kd | = | 261.0 | nM | 6.58 |
| CHEMBL4793684 | — | Kd | = | 274.0 | nM | 6.56 |
| CHEMBL4761635 | — | Kd | = | 877.0 | nM | 6.06 |
| CHEMBL4779103 | — | Kd | = | 1459.0 | nM | 5.84 |
| CHEMBL184618 | FRAMYCETIN | Kd | = | 1950.0 | nM | 5.71 |