Assay Detail
Binding
CHEMBL5582964
Review assay metadata, readout intent, target linkage, and publication context from the same page.
Binding affinity to human G4-quadruplex 22AG DNA 5'- AGGGTTAGGGTTAGGGTTAGGG -3' assessed as change in fluorescence intensity at 1 uM incubated for 0.5 hrs in presence of different concentrations of DNA by fluorescence spectra analysis
6
Total Activities
6
Compounds Tested
2
Activity Types
0
Assay Parameters
Assay Information
| Assay Type | Binding |
| Organism | Homo sapiens |
| Confidence | 3 — Cell-line / Tissue |
| Curated By | Autocuration |
Publication
A Comparative Study on the DNA Interactions and Biological Activities of Benzophenanthridine and Protoberberine Alkaloids.
Activity Statistics
| Type | Count | Avg pChEMBL | Best pChEMBL |
|---|---|---|---|
| Kd | 3 | 5.53 | 6.55 |
| Activity | 3 | - | - |
Compounds Tested
| Compound | Name | Phase | Activities | Best pChEMBL |
|---|---|---|---|---|
| CHEMBL5594821 | — | — | 1 | 6.55 |
| CHEMBL362071 | COPTISINE | — | 1 | 5.23 |
| CHEMBL295124 | BERBERINE | 4.0 | 1 | 4.81 |
| CHEMBL417799 | SANGUINARIUM | 2.0 | 1 | - |
| CHEMBL13045 | CHELERYTHRINE | — | 1 | - |
| CHEMBL5593587 | — | — | 1 | - |
Activity Data
| Compound | Name | Type | Rel. | Value | Units | pChEMBL |
|---|---|---|---|---|---|---|
| CHEMBL5594821 | — | Kd | = | 280.0 | nM | 6.55 |
| CHEMBL362071 | COPTISINE | Kd | = | 5930.0 | nM | 5.23 |
| CHEMBL295124 | BERBERINE | Kd | = | 15610.0 | nM | 4.81 |
| CHEMBL417799 | SANGUINARIUM | Activity | - | — | - | |
| CHEMBL13045 | CHELERYTHRINE | Activity | - | — | - | |
| CHEMBL5593587 | — | Activity | - | — | - |